Id Trinity | FTRINITY_DN54367_c3_g9_i1 |
---|---|
Name Transcript | Ll_transcript_196332 |
Sequence | GAAGGGTTTTGTGCTGGGACGAGACCAGCTTCTGCTACAATATCACAGCCCTGAAGAACAATTCCTGAATTCATGGTCCTGTGTTCAGTGCCATCGGCAG TGATTGTGTTGAATTGACTTGCTTTGGGCTTTCTAACTATGATTCTTGAGTTTTGGATCAAGGTTGCTGATGTTCCAAAGATGAAGTCGATGGTGCCGGA GATTTCGCAGTTGCGGTAGAATTGACGGTTGGTTTGGACATACAAGCTATCTTGATAACCCACTATGTTGCAGTCGAAGAAGGCTGACATATCTCCTTGT TTTCTCAGTGCTACTGCTTGGTGTCCTTCTATACCAGCAGTGTTCTCGAATCTAATTCCCTTGGCAATGAATCCAGGTGCAGTATTGGCGAATGTGGCAG TCATCATGGTTTT BLAST |
Tissue | flowers |
Gene name | LI_gene_41991; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_196332
Blastp | Probable pectinesterase/pectinesterase inhibitor 58 from Arabidopsis with 51.47% of identity |
---|---|
Blastx | Probable pectinesterase/pectinesterase inhibitor 58 from Arabidopsis with 51.47% of identity |
Eggnog | pectinesterase(COG4677) |
Kegg | Link to kegg annotations (AT5G49180) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019441261.1) |
Pfam | Pectinesterase (PF01095.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |