Ll_transcript_196021

• Id Trinity: FTRINITY_DN54381_c1_g2_i1
• Name Transcript: Ll_transcript_196021
• Sequence: GACTGCCCCGGAGCAGGAGATGGAGAGACGAGACAAGGAAAGACTTGTCAAGATTCGTACACTTGGGAATATCCGTTTGATTGGAGAGCTGTTGAAGCAA AAAATGGTTCCTGAAAGGATTGTCCATCACATTGTTCAGGAGCTTTTAGGACCTCCTGACAGCAAGGTTTGTCCAGCTGAGGAAAATGTTGAAGCTATAT GTCAGTTTTTCAACACCATTGGTAAGCAGCTG
• Tissue: flowers
• Gene name: LI_gene_42071;
• Additional information: -

Expression of Ll_transcript_196021

FPKM

• FPAB: 0.6
• FPNAB: 1.1
• LF1: 2.6
• LF2: 2.7
• LF3: 2.5
• LF4: 0.5
• UF1: 0.5
• UF2: 0.6
• UF3: 2.4
• UF4: 1.9

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_196021

• Blastp: -
• Blastx: Eukaryotic translation initiation factor isoform 4G-1 from Oryza sativa with 87.18% of identity
• Eggnog: Eukaryotic translation initiation factor 4 gamma(ENOG410XS4P)
• Kegg: Link to kegg annotations (4336300)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_017440218.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;