Id Trinity | FTRINITY_DN54389_c0_g1_i21 |
---|---|
Name Transcript | Ll_transcript_197697 |
Sequence | ATTTCTCACTTGTTTTTATTGTTGAATTTCGATCGTCGTGGGTTCAGAATCTGAGCAAGATTGCATGCAATAGGCTTCAGAAAGAGCTTGTTGAGTGGCA GGTAAATCCCCCAACTGGTTTCAACCATAAAGTCACTGATAATCTCCAAAGGTGGGTTATTGAAGTGAGTGGTGCTCCTGGTACACTTTACACCAATGAG ACCTACCAGCTTCAAGTTGACTTTCCTGAGAACTACCCAATGGAAGCTCCTCAGGTAATATTCTTGAATCCTGCTCCCATGCATCCTCATATCTACAGTA ATGGCCATATTTGTTTAGATATATTGTATGATTCATGGTCCCCAGCTATGACCGTTAGTTCTATATGCATCAGTATCCTTTCAATGCTTTCAAGTTCAAC TGTAAAGCAACGCCCTGAGGATAATGAT BLAST |
Tissue | flowers |
Gene name | LI_gene_42128; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_197697
Blastp | Probable ubiquitin-conjugating enzyme E2 16 from Arabidopsis with 88.28% of identity |
---|---|
Blastx | Probable ubiquitin-conjugating enzyme E2 16 from Arabidopsis with 88.28% of identity |
Eggnog | ubiquitin-conjugating enzyme(COG5078) |
Kegg | Link to kegg annotations (AT1G75440) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019422424.1) |
Pfam | Ubiquitin-conjugating enzyme (PF00179.25) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |