Ll_transcript_239025

• Id Trinity: FTRINITY_DN54401_c7_g1_i11
• Name Transcript: Ll_transcript_239025
• Sequence: AGAAGAAGAATCCCCTGGTGTTTATGGATGTGTCCATTGATGGGGATCCTTTTGAAAGGATTGTTTTTGAGCTTTTCTACGACGTTGCTCCAAAGACTGC AGAAAACTTTCGTGCACTATGCACAGGTATAACAAATTTGATTTCCAATAGACATTTCTTCAATCCTACCACTTTTTTATTGGAATTTTCCCTTTTCCTT GCAATACTCACATTTTCTACCATCATGATAACTTACTCACCAAATAAAGATGTTCAAAGGTATGTTTATGTCCTTATTTTTATTTGGGTAACACATGTAT ATGTACCTTGTTTCCATGAAACTATCATTGAGATTTGACAAAGTTTTACGTTG
• Tissue: flowers
• Gene name: LI_gene_42271;
• Additional information: details;

Expression of Ll_transcript_239025

FPKM

• FPAB: 0
• FPNAB: 0.2
• LF1: 0
• LF2: 0
• LF3: 0
• LF4: 0.2
• UF1: 0
• UF2: 0
• UF3: 0.7
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_239025

• Blastp: Peptidyl-prolyl cis-trans isomerase CYP95 from Arabidopsis with 83.33% of identity
• Blastx: Peptidyl-prolyl cis-trans isomerase CYP95 from Arabidopsis with 83.33% of identity
• Eggnog: peptidyl-prolyl cis-trans isomerase activity(COG0652)
• Kegg: Link to kegg annotations (AT4G32420)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019437701.1)
• Pfam: Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD (PF00160.20)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;