Id Trinity | FTRINITY_DN54416_c3_g1_i12 |
---|---|
Name Transcript | Ll_transcript_237286 |
Sequence | GAAATAATGCCCGGTCTGGTACTCATTATTGTTGGGTAAGTTCATTACATTTGGTTTGCTTGTTGTGAAGATGGACAGATGATTTGTCTCATGAGGAAGT AAGATATTGTTCATCATGAGATATAACTAAGTGAAGGGATTCTTTCTTTCATTTAAAAGTTTTAAAATGATGTAGATTATAGAGTTTCTGTGTTTGTATG CTTTGAAGATATCTTGATTGGTGGGTACTCAAATTTTGTTTCTCTTTGCAGGTAAACAGACCATCAGTTATATTCATAGATGAAATTGATGCATTGGCAA CTAGGCGTCAAGGTATTTTCAAGG BLAST |
Tissue | flowers |
Gene name | LI_gene_42417; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_237286
Blastp | - |
---|---|
Blastx | Probable inactive ATP-dependent zinc metalloprotease FTSHI 1, chloroplastic from Arabidopsis with 92% of identity |
Eggnog | Acts as a processive, ATP-dependent zinc metallopeptidase for both cytoplasmic and membrane proteins. Plays a role in the quality control of integral membrane proteins (By similarity)(COG0465) |
Kegg | Link to kegg annotations (AT4G23940) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019423765.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |