Ll_transcript_17998

• Id Trinity: FTRINITY_DN54519_c2_g1_i12
• Name Transcript: Ll_transcript_17998
• Sequence: ATTGATGTCTCTGCCTCCAACACTAGTGGTGCTTGGGATAATGCCAAGAAGTATATTGAGGTAAAGATTTCATTATGTTGTGTATGATTATTTGCTGTAA TGTAAATGAATGAATGATATGGATTTTGTGGTGAATAAATGTTTGGTGTAACAGGCTGGTGCTTCTGAGCATGCAAGAACTCTTGGTCCAAAAGAGTCAG ACCCACACAAAGCAGCTGTAATTGGTGACACCAT
• Tissue: flowers
• Gene name: LI_gene_43402;
• Additional information: -

Expression of Ll_transcript_17998

FPKM

• FPAB: 1.1
• FPNAB: 1.1
• LF1: 1.5
• LF2: 0.5
• LF3: 2.5
• LF4: 2.9
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_17998

• Blastp: -
• Blastx: Pyrophosphate-energized vacuolar membrane proton pump 1 from Arabidopsis with 77.78% of identity
• Eggnog: pump that utilizes the energy of pyrophosphate hydrolysis as the driving force for(COG3808)
• Kegg: Link to kegg annotations (AT1G15690)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_004508424.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;