Id Trinity | FTRINITY_DN54586_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_17452 |
Sequence | ATCACCTCACACTCCTTTACGAGCTTGTTGAGCACATCAATTTTGAAGAAGGGCTGGTTCAGGACATCTTGGATAAAAGGTAAGCGAATTAGTGCACCCG TTTGCTTATCATATTTCTTTATTATCTTTACTAGACCTGCAAAAGGAATGGGAAATGAGATAGAGGAAAAACAATCATTCTAAGCACTCATCATAAAAAA ACCCTCCTACTCCAACAAACTCTCTTTTACTATTGATCCATGTCATAGAAGACTTTGCATAGTTTTATGTTTGCTGAGGAAAGAGTCAAGGAGTTCTCAA GCCAATTATAACTAC BLAST |
Tissue | flowers |
Gene name | LI_gene_43950; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_17452
Blastp | - |
---|---|
Blastx | SPX domain-containing protein 1 from Oryza sativa with 74.47% of identity |
Eggnog | positive regulation of cellular response to phosphate starvation(ENOG4111K3Y) |
Kegg | Link to kegg annotations (4341465) |
CantataDB | Link to cantataDB annotations (CNT0001723) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019447544.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |