Id Trinity | FTRINITY_DN54636_c0_g2_i4 |
---|---|
Name Transcript | Ll_transcript_1051 |
Sequence | GTCGGGTTTTTTTGCTCGTTCATTGTGATTTGCTCTTCTTTGTGTTTAGTGATCATACTGGGAAAAAGTTACTATGATTTCACTTTGTATTGCAGCCTAT CAAAATGTTGGAAGATTTTTTGAGATTGGCTTCAGGAAACACACGGAAGAACTTAGAGACATGTGGTGTTCTTGCCGGTTCCCTGAAAAACAGGGTTTTC CTTATCACTACACTTATAATCCCAA BLAST |
Tissue | flowers |
Gene name | LI_gene_44459; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_1051
Blastp | - |
---|---|
Blastx | AMSH-like ubiquitin thioesterase 3 from Arabidopsis with 76.74% of identity |
Eggnog | Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome (By similarity)(COG1310) |
Kegg | Link to kegg annotations (AT4G16144) |
CantataDB | Link to cantataDB annotations (CNT0000606) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019462579.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |