Id Trinity | FTRINITY_DN54705_c0_g2_i2 |
---|---|
Name Transcript | Ll_transcript_157763 |
Sequence | CAAAAACCGAGGTTCAAATGCTTGAAATCACGAACAACTTTGCCACGTGAATCCTCAACTTCGATAACCTTGGCGTGAACCTTGATGCTCATGTCGTCAA GGACGTTCATCGTTTCTGAAAATAGAATCGTCTTCATGATTTCACACTATCGAAGTTCTCTCTGTGTGAGTGTGAGAGCGATTAGGGTTTTTTCGAGTCC CACATGCTCGAATCGGGTCACGGAGTAACCCTCCTCTTCGTCCAGCGGCAGCAACCACAAGTAAGGACCACCAACGGCGGGTGGTCACGGTGGTGACACG ATCCTGGCCATGAATGGCTTACGAGTAGAGCAAGATCGCTCCAGATAGCATCTTAATGTCGAAGGAACTCAAATGGATTCGGTAAGGGATTAAACCCTAT CTATTAC BLAST |
Tissue | flowers |
Gene name | LI_gene_45019; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_157763
Blastp | - |
---|---|
Blastx | 60S ribosomal protein L9-1 from Arabidopsis with 75.56% of identity |
Eggnog | This protein binds to the 23S rRNA, and is important in its secondary structure. It is located near the subunit interface in the base of the L7 L12 stalk, and near the tRNA binding site of the peptidyltransferase center (By similarity)(COG0097) |
Kegg | Link to kegg annotations (AT1G33120) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019431546.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |