Id Trinity | FTRINITY_DN54903_c3_g1_i5 |
---|---|
Name Transcript | Ll_transcript_101375 |
Sequence | GTTTAAGTCTATGGTTGTTGAGCTTATGGTTTTGGCTGGAGCTCTCAATATAGGTGATTTCATTCCTGCATTGGAGTGGCTTGATATTCAGGGTCTTCAA GCCAAGATGAAGAAATTACACAACAAGTTTGATGCTTTTTTAACCAACATTATAGAGGAACACAAAGTTTCTAGAAGTGAGAAACATCAAGATATGTTGA GTACTTTGTTGTCACTTAAAGATGTCCCAGAAGATGGAGGCAAACTCGCTGATATAGAGATCAAAGCATTGCTTTTGGTATGTAGTCTACACATTCATAA CATTCATTACACATGCTCACATATTCAATTAAG BLAST |
Tissue | flowers |
Gene name | LI_gene_46813; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_101375
Blastp | Flavonoid 3'-monooxygenase from Petunia with 69.15% of identity |
---|---|
Blastx | Flavonoid 3'-monooxygenase from Petunia with 69.15% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019451686.1) |
Pfam | Cytochrome P450 (PF00067.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |