Id Trinity | FTRINITY_DN54959_c2_g1_i4 |
---|---|
Name Transcript | Ll_transcript_101813 |
Sequence | AGGTTTATGCATTTGTTGCTCCTAAAATTATTGGTGGAAAGAATGCACCATCTCCTGTTGGTGAGCTTGGGATGGTTGAGATGTCACAGGCTTTAAACCT AACTGATGTTTGCTATAAGCAGGTAGTTAATAAGCTTTTTCCTTAGAAGTACTAAGATTTTCACCTTTCAAAAAATACACATCTAATCCGGATACTATTG CTGAATGTATCACATGTGTCAAGGAAAAAGATATGATCTGTAG BLAST |
Tissue | flowers |
Gene name | LI_gene_47287; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_101813
Blastp | - |
---|---|
Blastx | Riboflavin biosynthesis protein PYRR, chloroplastic from Arabidopsis with 82.93% of identity |
Eggnog | Converts 2,5-diamino-6-(ribosylamino)-4(3h)-pyrimidinone 5'-phosphate into 5-amino-6-(ribosylamino)-2,4(1h,3h)- pyrimidinedione 5'-phosphate (By similarity)(COG0117) |
Kegg | Link to kegg annotations (AT3G47390) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020218516.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |