Id Trinity | FTRINITY_DN55031_c2_g3_i7 |
---|---|
Name Transcript | Ll_transcript_67796 |
Sequence | GGACACTGATTCTGAGGAAGAGCTGAAAGAGGCATTTCGGGTTTTCGACAAGGATCAGAATGGGTTCATTTCTGCTGCTGAACTTCGCCATGTGATGACC AACCTCGGGGAGAAGCTCACTGATGAAGAAGTCGATGAGATGATTCGAGAGGCTGATGTTGATGGTGACGGCCAAATAAACTACGATGAATTTGTTAAGG TTATGATGGCCAAGTGAGAC BLAST |
Tissue | flowers |
Gene name | LI_gene_47936; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_67796
Blastp | - |
---|---|
Blastx | Calmodulin-2/4 from Solanum with 100% of identity |
Eggnog | Calcium-binding protein(COG5126) |
Kegg | - |
CantataDB | Link to cantataDB annotations (CNT0001037) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_012569225.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |