Ll_transcript_67737

• Id Trinity: FTRINITY_DN55041_c0_g2_i12
• Name Transcript: Ll_transcript_67737
• Sequence: AAAAGTGTTTCTGAGCTCAAAGACATCTGGGAAGGGAAAGAGGCCTGGGAAAGGTGGGAATCGTTTTTGGAAGTCAATTGGACTTGGATTTAAGACTCCC AGAGATGCCATTGAAGGAACATATATTGACAAGAAGTGCCCCTTCACCGGCAATGTTTCTATCCGAGGCCGTATCTTATCAGGAACTTGTCACAGTGCTA AGATGAACAGGACAATTATTGTTAGGAGGAACTATCTTCATTTTATCAAGAAGTATCAAAGGTATGAGAAGAGGCATTCAAATATTCCTGCTCACGTATC GCCTTGCTTCCGTGTGAAGGAAGGAGATCATGTTATTATTGGCCAATGCAGAC
• Tissue: flowers
• Gene name: LI_gene_48022;
• Additional information: details;

Expression of Ll_transcript_67737

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0
• LF2: 0.7
• LF3: 0.3
• LF4: 1.6
• UF1: 1.1
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_67737

• Blastp: 40S ribosomal protein S11 from Soja with 94.02% of identity
• Blastx: 40S ribosomal protein S11 from Soja with 94.02% of identity
• Eggnog: One of the primary rRNA binding proteins, it binds specifically to the 5'-end of 16S ribosomal(COG0186)
• Kegg: Link to kegg annotations (547984)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_014507393.1)
• Pfam: Ribosomal_S17 N-terminal (PF16205.4)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;