Ll_transcript_67749

• Id Trinity: FTRINITY_DN55041_c0_g2_i23
• Name Transcript: Ll_transcript_67749
• Sequence: TGACAAGAAGTGCCCCTTGACCGGCAAGGTTTCTATCCGAGGCCGTATATTATCAGGAACTGTTCACAGTGCTAAGATGAATAGGACTATTATTGTTAGG AGGAACTATCTTCATTTTATTAAGAAGTATCAAAGGTATTTTCCTGTCTCATTTTTTGTCCAGTTATGTAGTACTAGGTATAAAGAAACTAAACTTTATC AGGTAAATATGCTTCCTATTTTCTTATGTTATTTAGGTATGAGAAGAGACATTCAAACATCCCTGCTCATGTGTCACCCG
• Tissue: flowers
• Gene name: LI_gene_48022;
• Additional information: -

Expression of Ll_transcript_67749

FPKM

• FPAB: 0
• FPNAB: 1.4
• LF1: 0.3
• LF2: 0
• LF3: 0
• LF4: 0
• UF1: 0.3
• UF2: 0
• UF3: 0
• UF4: 0.3

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_67749

• Blastp: -
• Blastx: 40S ribosomal protein S11 from Soja with 91.3% of identity
• Eggnog: One of the primary rRNA binding proteins, it binds specifically to the 5'-end of 16S ribosomal(COG0186)
• Kegg: Link to kegg annotations (547984)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019441103.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;