Ll_transcript_22409

• Id Trinity: FTRINITY_DN55126_c0_g6_i3
• Name Transcript: Ll_transcript_22409
• Sequence: TCGCCCGATCGTTTTGATGGGGGAAGTTTTGCCAAACTTTTTGTTGGATCTGTTCCCCGTACAGCCACTGAAGAAAATATTCGGCCTTTGTTTGAGGAAC ATGGGAATGTGGTCGAGGTTGCCCTGATCAAAGATAAAAAAACTGGACAGCATCAAGGTTGTTGTTTCATAAAGTATGCTACGTCTGAAGATGCTGACCA GGCAATTAGAGCATTGCACAATCAACATACTCTTCCTGGAGGTATTGGTCCAA
• Tissue: flowers
• Gene name: LI_gene_48788;
• Additional information: -

Expression of Ll_transcript_22409

FPKM

• FPAB: 2.1
• FPNAB: 2.7
• LF1: 0
• LF2: 5.4
• LF3: 1.1
• LF4: 2.2
• UF1: 1.8
• UF2: 3.9
• UF3: 3.4
• UF4: 5.2

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_22409

• Blastp: -
• Blastx: Flowering time control protein FCA from Arabidopsis with 79.27% of identity
• Eggnog: CUGBP, Elav-like family member(ENOG410XNTW)
• Kegg: Link to kegg annotations (AT4G16280)
• CantataDB: Link to cantataDB annotations (CNT0000624)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_015936884.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;