Id Trinity | FTRINITY_DN55167_c5_g1_i6 |
---|---|
Name Transcript | Ll_transcript_20772 |
Sequence | AACCTTCATAGCTTACGTCATTGACTTGCCATATCACTAAGCTTTTTCATCTCTCTCTCTCTCTTCAAACCAAGCTCCCCTGGTTTTTGCTGCAATGGGT TGTGTTGGATCATCACAATCCAAGGTTGATGGGGCACTAAAAAAGATCCGGAAGCCTAAACCTTGGAAGCATCCTCAGCCAATAACGAAGACTCAGCTTA TGCAATTGCGTGATGAATTTTGGGACACCTCTCCTCATTATGGTGGCCGGAAAGAGATTTGGGACGCGCTTCGAGCCGCTGCAGAGGCCGATGATCTATC CTTAGCACAAGCAATTGTGGATAGTGCTGGGGTCATTGTGCAGAGTTCTGATTTAACAGTATGCTATGATGAAAGAGATTATGGTGGAACCATTTCACTG TTCTAGAAAGCTCAGTTGCCCCACCACATAAGCATGAGCAAAGTATGAGCTACCTAAG BLAST |
Tissue | flowers |
Gene name | LI_gene_49123; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_20772
Blastp | Ubiquitin domain-containing protein 1 from Silurana with 49.09% of identity |
---|---|
Blastx | Ubiquitin domain-containing protein 1 from Danio with 47.66% of identity |
Eggnog | Ubiquitin domain containing(ENOG410XRPV) |
Kegg | Link to kegg annotations (448143) |
CantataDB | Link to cantataDB annotations (CNT0000677) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019425711.1) |
Pfam | Ubiquitin-binding domain (PF16455.4) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |