Id Trinity | FTRINITY_DN55197_c4_g1_i1 |
---|---|
Name Transcript | Ll_transcript_22691 |
Sequence | AAGACGGTAAAAATGATGACAAATGGTGGTTACCAACACCTAAGGTTCCTGTTGATGGTTTATCTGACGTTGCAAGAAAGTTTCTGCAATATCAAAAAGA CTGTGTGACTCAAGTACTTAAAGCAGCTATGGCTATAAATGCCCAAACTCTATCAGAAATGGAAATCCCTGAAAGCTATATAGAATCCCTACCGAAGAAT GGAAGAGCAAGTCTAGGGGACACAATCTACCGTAGTATCACAGATGATTATTTTGATCCTGACCAGTTACTAGGCACTATGGACTTATCATCAGAACATA AAATCCTAGATCTCAAGAATAAAATTGAGGCATCAATCGTA BLAST |
Tissue | flowers |
Gene name | LI_gene_49375; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_22691
Blastp | Rop guanine nucleotide exchange factor 12 from Arabidopsis with 77.19% of identity |
---|---|
Blastx | Rop guanine nucleotide exchange factor 12 from Arabidopsis with 77.19% of identity |
Eggnog | guanine nucleotide exchange factor(ENOG410YG86) |
Kegg | Link to kegg annotations (AT1G79860) |
CantataDB | Link to cantataDB annotations (CNT0002139) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019455305.1) |
Pfam | PRONE (Plant-specific Rop nucleotide exchanger) (PF03759.12) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |