Ll_transcript_139666

• Id Trinity: FTRINITY_DN55215_c4_g5_i12
• Name Transcript: Ll_transcript_139666
• Sequence: AAAGAGAAAGGTTTATCTGTGTCCTGAACCCACATGTGTTCACCATGACCCTTCAAGGGCTCTTGGAGACCTCACTGGGATTAAGAAACACTACTCTCGC AAGCATGGTGAGAAAAAATGGAAGTGTGAGAAGTGTTCTAAGAAATATGCAGTTCAATCAGATTGGAAAGCTCATTCTAAGACTTGTGGCACCAGAGAAT ATAGATGTGACTGTGGCAC
• Tissue: flowers
• Gene name: LI_gene_49518;
• Additional information: -

Expression of Ll_transcript_139666

FPKM

• FPAB: 1
• FPNAB: 11.1
• LF1: 0
• LF2: 0
• LF3: 0.8
• LF4: 0.6
• UF1: 1.8
• UF2: 3.5
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_139666

• Blastp: -
• Blastx: Protein indeterminate-domain 4, chloroplastic from Arabidopsis with 95.83% of identity
• Eggnog: Zinc finger protein(COG5048)
• Kegg: Link to kegg annotations (AT2G02080)
• CantataDB: Link to cantataDB annotations (CNT0000237)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_013470291.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;