| Id Trinity | FTRINITY_DN55349_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_64169 |
| Sequence | AAGCAGCTGATTGTTGGTGTGAACAAGATGGACTCCACCGAGCCTCCCTTCAGTGAAGCTCGATTTGAGGAAATTAAGAAGGAGGTGTCTTCTTATATTA AGAAGATCGGGTACAATCCCGCTGCGGTCGCCTTCGTGCCCATCTCCGGCTGGCACGGCGACAACATGCTGGAGCCCTCTGCCAAGATGGGCTGGTACAA GGGATGGGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_50606; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_64169
| Blastp | - |
|---|---|
| Blastx | Elongation factor 1-alpha from Bombyx with 92.75% of identity |
| Eggnog | This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis (By similarity)(COG5256) |
| Kegg | Link to kegg annotations (693059) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_012571171.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |