| Id Trinity | FTRINITY_DN55868_c21_g1_i3 |
|---|---|
| Name Transcript | Ll_transcript_268320 |
| Sequence | GGCCTTCCAGAGGTTTGGAAAGATGCTTGCAGATATTGAGAAAAAACTCGTACTCAGGAACGCTGATGAGAACCTGAAAAACCGCACCGGGCCAGCTACG CTTCCTTACACTTTGCTTTATCCGTCAAGCGAGGAAGGATGGACTTTCAGAGGAATTCCCAACAGGATCTCTATCTAAAAGGACTATATGGTTTCCTATA CTCCCTTTTTACCTACCAATAAGAGAGATGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_55188; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_268320
| Blastp | - |
|---|---|
| Blastx | Linoleate 9S-lipoxygenase-4 from Soja with 74.14% of identity |
| Eggnog | Plant lipoxygenase may be involved in a number of diverse aspects of plant physiology including growth and development, pest resistance, and senescence or responses to wounding (By similarity)(ENOG410YN4N) |
| Kegg | - |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019448240.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |