| Id Trinity | FTRINITY_DN55944_c0_g2_i16 |
|---|---|
| Name Transcript | Ll_transcript_249669 |
| Sequence | TATGGTCAGAATGATTTTCATCATCCCTTCAATTATTTAGAAATATTTCAATTTAATATTATGACATTTGCTTGTACTTCTTTCAGGGAGTTGGCTATCC ACTTGATGTTGTTGTTTGTAGTGCTTTGGGTGCTGACATGTATGATTGTGTTTATCCTACCCGTACAGCACGTTTTGGCACTGCTCTTGTTCCTGAGGTG ATCATATTTTATCCTGTTATTGAAAGTTTGTAACATTCTCCTTTTCTCCTTATACGCGCACGAAGATTTAATTCCACCCATTCATGCTTCCTTTTTTCCC GTTACTATTGCAGGGAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_55900; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_249669
| Blastp | - |
|---|---|
| Blastx | Queuine tRNA-ribosyltransferase catalytic subunit from Caenorhabditis with 73.68% of identity |
| Eggnog | Exchanges the guanine residue with 7-aminomethyl-7- deazaguanine in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr). After this exchange, a cyclopentendiol moiety is attached to the 7-aminomethyl group of 7-deazaguanine, resulting in the hypermodified nucleoside queuosine (Q) (7-(((4,5-cis- dihydroxy-2-cyclopenten-1-yl)amino)methyl)-7-deazaguanosine) (By similarity)(COG0343) |
| Kegg | Link to kegg annotations (CELE_ZK829.6) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019416066.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |