Id Trinity | FTRINITY_DN55944_c0_g2_i19 |
---|---|
Name Transcript | Ll_transcript_249672 |
Sequence | GGATACCGAACCACGTGGAATCAAAAATTTCTTAGGTCAAATTTGAGGCGCCATGTATGGAATGATGACTATTAGCATCAATTTTCCTCTGACTCAGATA CCAAAAATGAAAACATGGATTACCAATTCAAAATCAAATAATAAAAAGTTTTGGCCGTCACACATATTCCACAACCATAAAGGAACTAATACCACTGTGC TGTGTTCTGCTCCTGATATAAACCCTATGGCGCTTCGTTTTGAGGTTCTTGCCAGGTTCAACCGAGCTCGTGCAGCTCGATTGACACTCCCTCACTTTGT GTGTGAAACGCCTTTATTTATGCCAGTAGGCACACAAGGGACTATAAAAGGATTGACTAATAGCCAGCTTGAGGATATTGGCTGCCA BLAST |
Tissue | flowers |
Gene name | LI_gene_55900; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_249672
Blastp | Queuine tRNA-ribosyltransferase catalytic subunit 1 from Danio with 57.41% of identity |
---|---|
Blastx | Queuine tRNA-ribosyltransferase catalytic subunit 1 from Danio with 57.41% of identity |
Eggnog | Exchanges the guanine residue with 7-aminomethyl-7- deazaguanine in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr). After this exchange, a cyclopentendiol moiety is attached to the 7-aminomethyl group of 7-deazaguanine, resulting in the hypermodified nucleoside queuosine (Q) (7-(((4,5-cis- dihydroxy-2-cyclopenten-1-yl)amino)methyl)-7-deazaguanosine) (By similarity)(COG0343) |
Kegg | Link to kegg annotations (393985) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019416066.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |