Id Trinity | FTRINITY_DN56008_c4_g1_i1 |
---|---|
Name Transcript | Ll_transcript_72476 |
Sequence | GTATTTATAGTCCCTTTCTCCACCACAAACTTGTAATACAGAGGCATTAGCCACAAGCAGTAATGGTTAAAGGACTAGAGGCTCTGTCACATATGACCAA TGGTACAGGGAATGGAGACCAATCACATTTCGATCCAGGTGCTCCTCCACCTTTTAAGATAGCAGAAATCAGAGCTGTTATTCCTAAACATTGCTGGGTT AAGAATCCATGGAAGTCTCTAAGTTATGTTCTTAGGGATCTCTTAATAGTCACTGCATTGATAGCTGCAGCAATATGGTTCAATAGCTGGTTCTTTTGGC CACTTTATTGGGTTGCTCAGGGTACAATGTTTTGGGCTATATTTGTTCTTGGACATGATTGTGGTCATGGAAGCTTTTCAGACAGTACAAAGCTAAATAA CCTTGTCGGCCACATCTTGCACTCCTCAATTCTTGTACCATTCCATGGATGGAGAATTAGCCATAGAAC BLAST |
Tissue | flowers |
Gene name | LI_gene_56550; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_72476
Blastp | Omega-3 fatty acid desaturase, endoplasmic reticulum from Vigna with 76.92% of identity |
---|---|
Blastx | Omega-3 fatty acid desaturase, endoplasmic reticulum from Vigna with 76.92% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019420031.1) |
Pfam | Domain of unknown function (DUF3474) (PF11960.7) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |