Id Trinity | FTRINITY_DN56022_c0_g2_i2 |
---|---|
Name Transcript | Ll_transcript_70964 |
Sequence | ATAGCATCCGGAACTTCTGAGAATACTAAGGTGGTGATTGATCATGGGGCAGTTCCTATATTTGTGAAGCTACTCAGTTCACCTAGTGAGGATGTTCGGG AGCAGGCAGTGTGGGCACTGGGAAATGTTGCTGGTGACTCCCCTCGTTGTCGGGATCTAGTTCTCAGCCAGGGTGCTTTGATCCCACTATTGGCCCAGTT GAATGAGCATGCAAAACTTTCAATGCTGCGAAATGCCACATGGACACTATCAAACTTTTGCAGGGGCAAGCCACAACCTCCGTTTGAGGAAGTGAGGCCA GCACTCCCAG BLAST |
Tissue | flowers |
Gene name | LI_gene_56660; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_70964
Blastp | Importin subunit alpha-2 from Arabidopsis with 91.26% of identity |
---|---|
Blastx | Importin subunit alpha-2 from Arabidopsis with 91.26% of identity |
Eggnog | importin subunit alpha(COG5064) |
Kegg | Link to kegg annotations (AT4G16143) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020227577.1) |
Pfam | Armadillo/beta-catenin-like repeat (PF00514.22) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |