Id Trinity | FTRINITY_DN56114_c1_g1_i4 |
---|---|
Name Transcript | Ll_transcript_227192 |
Sequence | TCTACCGTGGAAGAATGAGTTCGTCTTCTATGGATGCTTTTCCTGCAATTCAGGACATTTTGCTGGAGTTCCGTGCTGGTAGAATGTTTCTTGAGGGTAA AACGGTTGTCCCTGATCCACGTAAAGGGCTTTTTCGTGTTGCAACGGGTGAGGAGGGGTTAGTCCATTTTCAGTGGCTTGATCGAACACAGAATGTTGTT GAAGATGATCAGATAATATTTCCGGGTGAAGCTGTTTTCGAGAAGGTTAATCAAGCATCTGGAAGAGTTTACATTTTGAAGTTCAATAGTGATGACAGGA AGTTCTTCTTCTGGATGCAGGAACCAGATTCTGAAAGTGACTCACAACTGTGTAGCTCAGTGAATGATTACCTTAACAGACAAATAGAGGTCCTTGGTGA TGAAGAGCCTGATGGATCCCTTCCACTTCAAGTTTCTGAAGATATGGCTGAGGATGACATCTCATCTAGGTAACATTGAACAATAATATGACCAAGGCTG TGATGTAATCATTTACATAGGGGAGCTGCAAACTTGATTGTCCCA BLAST |
Tissue | flowers |
Gene name | LI_gene_57414; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_227192
Blastp | 26S proteasome regulatory subunit RPN13 from Arabidopsis with 66.44% of identity |
---|---|
Blastx | 26S proteasome regulatory subunit RPN13 from Arabidopsis with 59.77% of identity |
Eggnog | Adhesion regulating molecule(ENOG410XSJJ) |
Kegg | Link to kegg annotations (AT2G26590) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019422183.1) |
Pfam | Proteasome complex subunit Rpn13 ubiquitin receptor (PF04683.12) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |