Id Trinity | FTRINITY_DN56161_c5_g1_i10 |
---|---|
Name Transcript | Ll_transcript_227503 |
Sequence | TTTCCATCAATTGTTTCTTGTGCAATGTTATGAAGTAATGTTATCCACTTTTTTCCTTCAGCTGAAACTTGATGGAGTAGAAGTTGATGAGGAACAGACC ATTTCGGATCCAGAATTACTAGCTGAGATTATGGATATCAGGGAAGAAGTTGAAGAAGCAACTAACTCTGAGACTTTGAATCACATCCTCTCTCAGATGC AGGAGAAAATGCAAACTTGGTCTACTGCCTTTGCTGATGCTTTTCAAAGTCAGAAATTTGAAGAAGCAAAAACTTCAATTCAGAGAATGACTTACTATAG TCGTG BLAST |
Tissue | flowers |
Gene name | LI_gene_57841; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_227503
Blastp | Iron-sulfur cluster co-chaperone protein HscB, mitochondrial from Homo with 30.1% of identity |
---|---|
Blastx | Iron-sulfur cluster co-chaperone protein HscB, mitochondrial from Homo with 30.1% of identity |
Eggnog | protein oligomerization(COG1076) |
Kegg | Link to kegg annotations (150274) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019443103.1) |
Pfam | HSCB C-terminal oligomerisation domain (PF07743.12) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |