Id Trinity | FTRINITY_DN56265_c1_g1_i2 |
---|---|
Name Transcript | Ll_transcript_59682 |
Sequence | TTACCATTGTCTTTATTACACCGTCGGCTTTATTCTTCAGTCGGCTCTTTTAGTCCCTTACTTTTCATGGAAATACAGCCATCGTCGCCACCACTCCAAC ACAGGATCTCTTGAGCGGGATGAAGTCTTTGTGCCTAAAAAGAAGTCCGGTATCCAATGGTACTCTAAATACCTTAACAACAACCCACTAGGCAGATTTA TCACACTTACTGTCACCCTTACCCTTGGCTGGCCCCTATACTTGGCTTTCAATGTTTCGGGCAGGCCTTACGAAAGATTTGCTTGTCACTTTGACCCATA TGGTCCAATTTTCTCGGCCCGCGAAAGACTCCACATATACCTATCTGATGCCGGACTACTTGCTGTATGCTATGGGCTATTCCATTTGGTCATGGCAAAA GGGCTTGCCTGGGTTGTTAGTGTTTATGGAGTTCCATTGCTAGTGGTGAATGGATTT BLAST |
Tissue | flowers |
Gene name | LI_gene_58669; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_59682
Blastp | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 from Soja with 82.24% of identity |
---|---|
Blastx | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 from Soja with 82.24% of identity |
Eggnog | linoleoyl-CoA desaturase activity(COG3239) |
Kegg | Link to kegg annotations (547815) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019440821.1) |
Pfam | Fatty acid desaturase (PF00487.23) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |