Id Trinity | FTRINITY_DN56267_c1_g1_i2 |
---|---|
Name Transcript | Ll_transcript_61558 |
Sequence | ATTATATGTTTTTACACTAACACTTCCTTCTTCTTCTGCTGTTTATTGGGCTTTTGGTGATGAGTTACTTAACCATTCCAATGCTTTCTCTCTTCTCCCA AAGAATGGTTTTCGTGATGCTGCTGTAATACTCATGCTCATTCATCAGTTTATCACATTTGGGTTTGCATGTACTCCACTATACTTTGTGTGGGAAAAAG TAATTGGAATGCATAACACAAGAAGCATTTGTGTGAGGGCACTAGCAAGGTTACCAGTGGTCATACCAATATGGTTCTTAGCTATAATCTTTCCATTCTT TGGACCAATTAACTCTGCTGTTGGTGCTTTACTTGTTAGCTTCACTGTCTATATCATACCTTCTTTAGC BLAST |
Tissue | flowers |
Gene name | LI_gene_58685; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_61558
Blastp | Auxin transporter-like protein 2 from Medicago with 94.21% of identity |
---|---|
Blastx | Auxin transporter-like protein 2 from Medicago with 94.21% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (MTR_7g067450) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019450308.1) |
Pfam | Transmembrane amino acid transporter protein (PF01490.17) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |