Ll_transcript_218316

Id TrinityFTRINITY_DN56319_c0_g1_i10
Name TranscriptLl_transcript_218316
SequenceTTTCATTCGCCAAAACTAAAAACTACGATGACAGCTTTCAGCGGCGATGAAACTGCTCCTTTCTTCGGCTTCCTCGGAGCCGCCGCGGCACTCGTTTTCT CATGTATGGGAGCTGCTTATGGAACAGCGAAGAGTGGAGTGGGAGTTGCATCTATGGGTGTGATGAGCCCTGAACTTGTAATGAAATCTATTGTTCCTGT TGTTATGGCTGGAGTTCTTGGAATTTATGGATTGATTATTGCTGTTATTATTAGTACTGGTATTAACCCTAAGGCTAAGTCTTATTATCTATTTGATGGT TATGCTCATTTATCATCTGGTCTTGCTTGTGGTCTTGCTGGTCTCTCTGCTGGTATGGCTATTGGAATTGTTGGTGATGCTGGTGTCAGGGCTAACGCCC AGCAGCCGAAGCTGTTCGTCGGTATGATCCTTATCTTGATTTTTGCTGAAGCTCTTGCTCTCTATGGCCTCATTGTGGGTATCATCCTC BLAST
Tissueflowers
Gene nameLI_gene_59147; 
Additional informationdetails; 

Expression of Ll_transcript_218316

Labels

FPAB abscising flower pedicels
FPNAB    non-abscising flower pedicels
LF1 lower flowers stage 1
LF2 lower flowers stage 2
LF3 lower flowers stage 3
LF4 lower flowers stage 4
UF1 upper flowers stage 1
UF2 upper flowers stage 2
UF3 upper flowers stage 3
UF4 upper flowers stage 4

Annotations of Ll_transcript_218316

BlastpV-type proton ATPase subunit c5 from Arabidopsis with 98.05% of identity
BlastxV-type proton ATPase subunit c5 from Arabidopsis with 98.05% of identity
EggnogF(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (By similarity)(COG0636)
KeggLink to kegg annotations (AT2G16510)
CantataDBLink to cantataDB annotations (CNT0000133)
Mirbase-
Ncbi proteinLink to NCBI protein (XP_019456971.1)
PfamATP synthase subunit C (PF00137.20)
Rfam-
GOLinks to GO: General; Genes and gene products; Annotations; Ontology;
Links to GO: General; Genes and gene products; Annotations; Ontology;