Ll_transcript_217441

• Id Trinity: FTRINITY_DN56357_c3_g5_i14
• Name Transcript: Ll_transcript_217441
• Sequence: TTTCTCTCTTCCTGGTGAGCCTCTTCCTGACAAAAGGTCAAGTACTTGAAACTTATTCATCCGAAGATGGAGTCATCTTTTTTGGTGACCTGAATCAAAG GAACATTCTGAACACTGGAGAATTTCCGGACACTAAATTCTTCACATCATTTTCCGAAATGGCTAAGAGGGTGTGGCTCTTACATTGCTTAGCCTTCTCT TTTGAGCCTCAAGCTTTCATTTTTCAAGTTGAGAAG
• Tissue: flowers
• Gene name: LI_gene_59484;
• Additional information: -

Expression of Ll_transcript_217441

FPKM

• FPAB: 0
• FPNAB: 2
• LF1: 0
• LF2: 1.3
• LF3: 0
• LF4: 3.7
• UF1: 0
• UF2: 2.4
• UF3: 3.1
• UF4: 1.6

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_217441

• Blastp: -
• Blastx: Protein GRAVITROPIC IN THE LIGHT 1 from Arabidopsis with 41.51% of identity
• Eggnog: Plant protein of unknown function (DUF641)(ENOG410YCXF)
• Kegg: Link to kegg annotations (AT5G58960)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019453545.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;