Id Trinity | FTRINITY_DN56371_c1_g2_i13 |
---|---|
Name Transcript | Ll_transcript_217479 |
Sequence | CAATCTCCTAACCTAAGTGAAAATGAGTAGACATTCAAGCAGAACTATCTACGTTGGGAATCTACCAGGTGATATTCGTGAAAGAGAAGTTGAAGATTTG TTTTTTAAGTATGGACACATAGCTCACATTGACCTAAAGGTTCCACCAAGGCCCCCAGGTTATGCATTTGTGGAGTTTGAAGATCCTCAAGATGCTGAAG ATGCTATTCGTGGGCGTGATGGCTATGATTTTGATGGGCACCGATTACGGGTGGAGCTTGCACATGGTGGGCGTGGTAATTCATCTTCAAGAGGAGACCG ATATAATAGTCGCAGCAATGGACGAGGTGAAGGTGGACGTGGGGGTGGGATATCTAAGCGCTCTGATTACCGTGGTGGGTAAAATGTTGAAACTCTTGTA AGGTGATTTTGAGGATGCTTTGGACATGGCTCTAATTTTTTCATCATTCCATATGCAGTTCTTGTCACAGGGTTGCCCTCTTCAGCTTCCTG BLAST |
Tissue | flowers |
Gene name | LI_gene_59600; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_217479
Blastp | Serine/arginine-rich-splicing factor SR34 from Arabidopsis with 83.91% of identity |
---|---|
Blastx | Serine/arginine-rich-splicing factor SR34 from Arabidopsis with 85.19% of identity |
Eggnog | Rna-binding protein(COG0724) |
Kegg | Link to kegg annotations (AT1G02840) |
CantataDB | Link to cantataDB annotations (CNT0000194) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019453086.1) |
Pfam | RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (PF00076.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |