Id Trinity | FTRINITY_DN56385_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_219481 |
Sequence | AAGCCATAAAGAAGTTCAATGTCTCAAAAAATGCACTTGCACAAGTTGCATGGAACTTTGTCAATGATGGGTATGATTAAGTTGTCAATTTTTTATATTA CCTTGTTGATTCAATTTTATTAATGTTTGTTTGCACCGTGGAAAGTGGCTTTCAGGTTGAGGACATCTCTCTTTTTGCAATTCAAGCCACATCATATTGC AGCTGGTGCCATTTTCCTTGCTGCCAAGTTCCTTAAAGTGAAGCTTCCATCAGACGGTGAAAAGGTTTGGTGGCAAGAGTTTGATGTCACCCCACGCCAA TTGGAAGAAGTTAGCAATCAAATGCTGGAACTCTATGAGCAGAATAAAATTCCACCATCTCAAGGAAGTGAAATAGAAGGAACTGCTGGAGGGACAAAAG CTGATGTGAAGGCTCCTGCTGTGAATGAGGAGCAAGCCTCAGAGCAAATATCATCTCATTCTGCCGCGAAACACTCATCTGCAGAAAAGGTTGAGGTACC ATTAAGAGGAACCGAAAACCAAATCAATGATGGGAGTGCTGAAATGGGCAGTGATATCACTGATCACAAGGTTGACTTAGAAATTGGGGATAGTCATAAC TCCGAGCCCCAGCAGCAGCCTAAGAAAGATAACAAGGGAGAAGTGGCAAATAGATCCAAGTCTGTGACTGAACAAACAAGTGCAGAAGACCAAGATCAAA ATTTGGAGCATCGGGAAGGCCTGCTCAATTACTCACCCAAAGATGCAATCAAGATGATTGACAAAGACAAAGTGAAGGCTGCCTTGAAGAAAAGGAGGAA GGAGCGAGGGGâBLAST |
Tissue | flowers |
Gene name | LI_gene_59695; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_219481
Blastp | Cyclin-T1-4 from Arabidopsis with 33.13% of identity |
---|---|
Blastx | Cyclin-T1-4 from Arabidopsis with 48.87% of identity |
Eggnog | Component of the Mediator complex, a coactivator involved in regulated gene transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Binds to and activates cyclin-dependent kinase cdk8 that phosphorylates the CTD (C-terminal domain) of the large subunit of RNA polymerase II (RNAp II), which may inhibit the formation of a transcription initiation complex(COG5333) |
Kegg | Link to kegg annotations (AT4G19600) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019419549.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |