Id Trinity | FTRINITY_DN56473_c2_g2_i3 |
---|---|
Name Transcript | Ll_transcript_202767 |
Sequence | TTTGGACCGGTCTGAGATCCCGGAGTACTTGACTGGAGAAGTGGCAGGAGACTATGGTTATGACCCATTTGGTCTTGGCAAGAAGCCAGAGGACTTCGCC AAGTATCAGTCATATGAGTTGATTCACGCCCGATGGGCAATGCTTGGCGCCGCCGGATTCATCATTCCTGAGGCCTTCAATAAATATGGAGCTAACTGTG GTCCTGAGGCTGTTTGGTTCAAGACAGGAGCTCTGCTTCTTGATGGGAATACATTGAACTACTTCGGCAAACCCATTCCGATCAATCTTGTCGTTGCGGT CGTTGCTGAGGTTGTTCTTTTGGGTGGTGCAGAGTACTACAGAATCACTAACGGCCTG BLAST |
Tissue | flowers |
Gene name | LI_gene_60436; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_202767
Blastp | Chlorophyll a-b binding protein CP26, chloroplastic from Arabidopsis with 94.12% of identity |
---|---|
Blastx | Chlorophyll a-b binding protein CP26, chloroplastic from Arabidopsis with 94.12% of identity |
Eggnog | Chlorophyll A-B binding protein(ENOG41110WY) |
Kegg | Link to kegg annotations (AT4G10340) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019449441.1) |
Pfam | Chlorophyll A-B binding protein (PF00504.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |