| Id Trinity | FTRINITY_DN56520_c4_g7_i1 |
|---|---|
| Name Transcript | Ll_transcript_156403 |
| Sequence | CACTTGATAGTTATTGCTAGTGTTAGGAAATTCATTCCTAGTTGAGGTACATGGATTCTGGTGACTAAGAATAGAGCTATGATCCGAAGCTACGTGATTA TGAATCAACTTGTTTGTACTGTGTTCTTCCCTTTCAGAACTTTTTTGAGCTTGTTGTGATTCTAGCATATGTATTTCTTCCACCATTGGTTTCCAAAGCC TTACTCTAGCATTAATAAACCAATTGGACACCTGACTACGAGACAGACCAGTTTGTTTAGCCAACATTAACTTGTCGGTGTCAGTCGGGTATGGGTGGAG AAAGTGAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_60841; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_156403
| Blastp | BEL1-like homeodomain protein 9 from Arabidopsis with 94% of identity |
|---|---|
| Blastx | BEL1-like homeodomain protein 9 from Arabidopsis with 94% of identity |
| Eggnog | homeobox(ENOG410XPMQ) |
| Kegg | Link to kegg annotations (AT5G02030) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019450259.1) |
| Pfam | Homeobox KN domain (PF05920.10) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |