Id Trinity | FTRINITY_DN56533_c0_g1_i2 |
---|---|
Name Transcript | Ll_transcript_156297 |
Sequence | ACTCAAAGTTGTTTCGCTTTCATGGTAGGATCTTGTGATGGAATGCTATGTTTCGCTGGTAGTCTAAACACTGCCCTTTTATGGAACCCCACTATTAGAG TATTCAAAAGGTTGCCACCTTTGGAAAAATACACCATATTTGGGTTTGGTTTTGATCAATGTAGTGACAGTTACAAAGTGGTTGCAATTTCAAACAATGT GTGTTCCAATGATGGTGGAAGCATTTGTGTACCTGAAGTTAAGATTCATAATTTGGGTACTGATTCTTGGAGAAGGATTCAGGAATATCCTTATGGTATT CC BLAST |
Tissue | flowers |
Gene name | LI_gene_60954; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_156297
Blastp | F-box/kelch-repeat protein At3g23880 from Arabidopsis with 32.67% of identity |
---|---|
Blastx | F-box/kelch-repeat protein At3g23880 from Arabidopsis with 32.67% of identity |
Eggnog | F-box Kelch-repeat protein(ENOG410Z2HM) |
Kegg | Link to kegg annotations (AT3G23880) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019439762.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |