Ll_transcript_154313

• Id Trinity: FTRINITY_DN56583_c2_g1_i12
• Name Transcript: Ll_transcript_154313
• Sequence: CAAGGATCAACAACTTGCTATTATCTCATTTAGTTGTTACTTTTTTATGTCTTTCATTGAGAGTTTTTACTTTTAATGCTTCTTTCATTGTATCAAAAAA CAATAGTTTTTTACTTAAAATCAGATGACTGTAACTTGGACAAGTGGATATGGAATCAATGAAGCTGAACCTTTTGTTCAATGGGGTGCAAAAGGAGAGG ATCATATACATTCCCCAGCTGGGACACTCACTTTCACTCGGGAGAGCTTGTGTG
• Tissue: flowers
• Gene name: LI_gene_61388;
• Additional information: -

Expression of Ll_transcript_154313

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0.4
• LF2: 0
• LF3: 0.9
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_154313

• Blastp: -
• Blastx: Probable inactive purple acid phosphatase 1 from Arabidopsis with 66.67% of identity
• Eggnog: Hydrolyzes cAMP to 5'-AMP. Plays an important regulatory role in modulating the intracellular concentration of cAMP, thereby influencing cAMP-dependent processes (By similarity)(COG1409)
• Kegg: Link to kegg annotations (AT1G13750)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019454483.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;