Id Trinity | FTRINITY_DN56647_c1_g1_i13 |
---|---|
Name Transcript | Ll_transcript_83524 |
Sequence | CTACTCTCCAGCTTGTGGGGGGGGTATTGAAGAATGTCACTAACTTGAGCTTGAAGAGAATCAAAGGAGTAGTTGAATTATGGGGACCAAATGGAACTCA GCCTTCAAAAGTGGATTATAAGGAGGAGATGGCAAAAATCAGAAGAATTATTGTTGATTTCCATGGTGAAATGGTTCTCCTAGTAAACTATAGCAACATT AATTACACGGGTTTGGCTAAAATTTTGAAGAAATATGACAAGAGAACAGGAGGGCTACTACGTTTACCATTCATTCAAAAAGTTCTAGAGCAACCCTTTT T BLAST |
Tissue | flowers |
Gene name | LI_gene_61909; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_83524
Blastp | SPX domain-containing protein 1 from Arabidopsis with 79.03% of identity |
---|---|
Blastx | SPX domain-containing protein 1 from Arabidopsis with 79.03% of identity |
Eggnog | Vacuolar transporter chaperone(COG5036) |
Kegg | Link to kegg annotations (AT5G20150) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019446998.1) |
Pfam | SPX domain (PF03105.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |