Ll_transcript_83527

• Id Trinity: FTRINITY_DN56685_c0_g1_i1
• Name Transcript: Ll_transcript_83527
• Sequence: GCCAACAGTGAAAAGGCAAGAGTTAAAGTGAACGTTCGTTTGAATCTACATGGAATTGTATCCATTGAGTCAGCAACTCTCATAGAAGAGGAAGAAACTG AGGTTCTAGTTTCTAAAGAACCAGCAGGAGAAAATACCAAGATGGAAACTGATGATGTTGCTGCTGCTGCTGCTGCCCCTGTGGCTGAAAACGGCCTCCC CGAGACAGGAGATAAGCCTGTGCAAATGGACATTGATACAAAGGTTGAGGCTCCAAAGAAAAAGGTAAAGAAAACAAACATTTCTGTTTCAGAGCTAGT
• Tissue: flowers
• Gene name: LI_gene_62263;
• Additional information: details;

Expression of Ll_transcript_83527

FPKM

• FPAB: 10.2
• FPNAB: 27.6
• LF1: 9
• LF2: 11.2
• LF3: 13.2
• LF4: 19.4
• UF1: 10
• UF2: 10.7
• UF3: 19.9
• UF4: 10

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_83527

• Blastp: Heat shock 70 kDa protein 14 from Arabidopsis with 53.39% of identity
• Blastx: Heat shock 70 kDa protein 15 from Arabidopsis with 50.43% of identity
• Eggnog: Heat shock protein(COG0443)
• Kegg: Link to kegg annotations (AT1G79930)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019436423.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;