Id Trinity | FTRINITY_DN56702_c1_g1_i2 |
---|---|
Name Transcript | Ll_transcript_190682 |
Sequence | ATCTCTTTTATGTTGTAATATATGTGTTTCTGGTATTTGTGTCGACAGCTGATATTCTCGCTCGCAAGATACGAAGCTGTAATTGATGCATACTTGGATG GTCTTGAGGCATCTGGCCTAGATGATCTTTCCAGAGTCACAAGTGTTGCTTCTTTCTTTGTTAGTCGAGTGGACACTCTTATCGACCAGTTGCTTGAGAA AATTGGCACCCCAGAGGCCCTTAACCTACGCGGGAAGGCAGCTGTAGCCCAAGCAGCCCTGGCATTCCAGCTTTACCAAAGGAAATTCTCTGGTCCAAGG TGGGAAGCTCTGGTTAAAAAAGGAGCCAAGAAGCAAAGACTCCTCTGGGCTTCAACCAGTGTGAAGAATCCTGCTTATCCTGACACCTTATATGTTGCCC CTCTTATTGGACCTGACACTGT BLAST |
Tissue | flowers |
Gene name | LI_gene_62416; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_190682
Blastp | Transaldolase from Frankia with 62.2% of identity |
---|---|
Blastx | Transaldolase from Acidothermus with 61.11% of identity |
Eggnog | Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway (By similarity)(COG0176) |
Kegg | Link to kegg annotations (Franean1_2074) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019418668.1) |
Pfam | Transaldolase/Fructose-6-phosphate aldolase (PF00923.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |