Id Trinity | FTRINITY_DN56756_c2_g6_i1 |
---|---|
Name Transcript | Ll_transcript_189648 |
Sequence | AAGACCCATTTCCACAGCTTCATTCAACAACCCCATTGCCTCATCTGATCTACCAACTTTGCATAACCCATCCATTACTGCAGTATAAGAATAAACATCA GGTTCCAAAAATTGGTTTTTTAACTTTTTTTCCTTCATACTCATCAAACACTCCAATGCTTCTTCAACCTTTCCCACATAACACAAACCCTTCAACAAAC AATTATATACCTTAACACCCTTTGACCCCACAACCTCGAAAACCTCCATAGCCTTCTTAATCTTCCCCCTTTTGCAAAGGGAATTAACAAGAACAGTGAC TGTTGCATCATTTGGTTGATACCCTTTTTTC BLAST |
Tissue | flowers |
Gene name | LI_gene_62912; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_189648
Blastp | Pentatricopeptide repeat-containing protein At1g64583, mitochondrial from Arabidopsis with 36.04% of identity |
---|---|
Blastx | Pentatricopeptide repeat-containing protein At1g64583, mitochondrial from Arabidopsis with 36.04% of identity |
Eggnog | Pentatricopeptide repeat-containing protein(ENOG410Z7Z7) |
Kegg | Link to kegg annotations (AT1G64583) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019416406.1) |
Pfam | PPR repeat (PF12854.6) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |