Id Trinity | FTRINITY_DN56781_c1_g1_i24 |
---|---|
Name Transcript | Ll_transcript_190028 |
Sequence | CAAAACAATAACAATTGTGGAGTTGATCAAGAGGAGAGTTGTGGGTCTCCACCAGAACACAGTCATTGGATCCACTGATATTACAGATACTTGGGAGCCC CTAGAGGAAGGCCTGCTTCCTTTGGAGACAACCAGGCATGTTTCAATGATAACAATTACACTTTCTAAGAACGAACTAGATACATCATCTGTGGGGTATC AGTCTCCAATACCAGCTGACCAGGTGAAGCCTTCTACAGATTTTGATTATGAAGGAGAGGGTTCCCCTAATGGTCGGGGTCGTGGTCGTGGTGGCCGAGG CAGGGGAAGGGCCAGAGGTA BLAST |
Tissue | flowers |
Gene name | LI_gene_63105; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_190028
Blastp | Ribonuclease P protein subunit p25-like protein from Mus with 42.25% of identity |
---|---|
Blastx | Ribonuclease P protein subunit p25-like protein from Mus with 38.03% of identity |
Eggnog | ribonuclease P MRP 25kDa(ENOG4111WGZ) |
Kegg | Link to kegg annotations (69961) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019453330.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |