Ll_transcript_187994

• Id Trinity: FTRINITY_DN56797_c4_g1_i5
• Name Transcript: Ll_transcript_187994
• Sequence: TTATAGAGAGTATAATTGACAAGGTGCTGAACCTTCCCTTGTGACATTAGGAACTTTCTGTCACTTATGTTTATTCTGCTGTATATTTTAATTTTTCTTC TGTCATCTTTTAACATTTGAATTTGGATTTCTTCAGACTTTCGAGGAAGCGGATACGAAACATGATGGCAAGATTGACAAGGAGGAGTGGAGAAACCTTG TTTT
• Tissue: flowers
• Gene name: LI_gene_63241;
• Additional information: -

Expression of Ll_transcript_187994

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 1.1
• LF4: 0
• UF1: 1.7
• UF2: 0
• UF3: 0.8
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_187994

• Blastp: -
• Blastx: Calcineurin B-like protein 6 from Oryza sativa with 95.65% of identity
• Eggnog: Calcium-binding protein(COG5126)
• Kegg: Link to kegg annotations (4351575)
• CantataDB: Link to cantataDB annotations (CNT0002341)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_013460076.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;