Id Trinity | FTRINITY_DN56829_c3_g1_i22 |
---|---|
Name Transcript | Ll_transcript_9548 |
Sequence | CCTGTGGGTAACAGACCCGGTGGGTATCAGCATGGGTCTGGGTCCAAAAATAAAGCAACGGGGCGGGTCTGGGTAATGCACTACCCGGACCCAACCAGAC CCATTGCCATCTCTACTCTTGTGAAAGCTGCTAATATTATTGAAGCAGCAAACGGATTGCAAGCTTGGAAGATGTTGGAGGATTTAACCAATCATATTGA TCTCATTTTAACTGAGGTTGCAATGCCTGGCTTATCTGGCATTGGTCTCCTATACAAGATTATGAGCCACAAAACACGGAAAAACATTCCAGTAATTA BLAST |
Tissue | flowers |
Gene name | LI_gene_63500; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_9548
Blastp | Two-component response regulator-like APRR7 from Arabidopsis with 58.02% of identity |
---|---|
Blastx | Two-component response regulator-like APRR7 from Arabidopsis with 58.02% of identity |
Eggnog | Transcription factor(COG5641) |
Kegg | Link to kegg annotations (AT5G02810) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427742.1) |
Pfam | Response regulator receiver domain (PF00072.23) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |