Id Trinity | FTRINITY_DN56868_c1_g1_i12 |
---|---|
Name Transcript | Ll_transcript_10422 |
Sequence | GCTTCAACTTCGCACAAGAAGAAGAAGAAGCCGCAGACACCATGGTGAAGTATTCAAGAGAACCAGACAATCCCACCAAATCTTGCAAGGCTAGAGGTGC CGACCTCAGAGTCCATTTCAAGAATACTAGGGAGACTGCCTTTTCCATTAGAAAGTTGCCCCTGGTTAAGGCCAAGAGGTATTTGGAGGATGTTTTGGCC CACAAACAGGCCATTCCATTCAGGCGCTTCTGCCGTGGTGTTGGGAGGACTGCTCAAGCAAAGAACAGACACTCTAACGGACAAGGACGCTGGCCTGTCA AATCCGCTAAGTTCATCTTAGATTTGCTTAAAAATGCTGAGAGTAATGCCGAAGTATGTCTGTTAAAATGTGTTCAATTTTATTTCTTCAACTTGAGGCA ACTTTGTAATCATTTTACTTCAATTACTTCTATACAGGTGAAAGGTTTGGATGTGGATGCTCTTTACATTTCTCACATCCAGGTTAATCAAGCACAGAGG CAGAGACGGCGCACATACCGTGCTCACGGAAGAATCAACCGTAAGTTTTAATCTATGCATTCTGGCTTTAATGGATGGTTATTACTTGGTTATATTGATG GTATTTTTTGTTCGTAGCCTACATGTCATCTCCTTGCCACATCGAGCTGATATTGTCTGAGAAGGAAGAACCCGTAAAGAAAGAGCCCGAGACCCAGTT BLAST |
Tissue | flowers |
Gene name | LI_gene_63839; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_10422
Blastp | 60S ribosomal protein L17-2 from Arabidopsis with 74.7% of identity |
---|---|
Blastx | 60S ribosomal protein L17-2 from Arabidopsis with 74.7% of identity |
Eggnog | The globular domain of the protein is located near the polypeptide exit tunnel on the outside of the subunit, while an extended beta-hairpin is found that lines the wall of the exit tunnel in the center of the 70S ribosome (By similarity)(COG0091) |
Kegg | Link to kegg annotations (AT1G67430) |
CantataDB | Link to cantataDB annotations (CNT0000618) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019414713.1) |
Pfam | Ribosomal protein L22p/L17e (PF00237.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |