| Id Trinity | FTRINITY_DN56868_c1_g1_i20 |
|---|---|
| Name Transcript | Ll_transcript_10433 |
| Sequence | GGACAAGGACGTTGGCCTGTCAAGTCTGCTAAGTTCATCTTAGATCTGCTCAACAATGCCGAGAGTAACGCCGAAGTATGTGATTATATGTCTTCAGTGT AATTTGCTTGTGGCTATTTGAAGCATAACTGTGTAGTCATTTTAATGTTGACTGTGTATTTGCAGGTGAAGGGTTTGGATATGGATGCTCTTTACATTTC TCACATCCAGGTTAATCAAGCACAGAGGCAGAGACGGCGCACATACCGTGCTCACGGAAGAATCAACCCCTACATGTCATCTCCTTGCCAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_63839; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_10433
| Blastp | - |
|---|---|
| Blastx | 60S ribosomal protein L17-1 from Hordeum with 62.89% of identity |
| Eggnog | The globular domain of the protein is located near the polypeptide exit tunnel on the outside of the subunit, while an extended beta-hairpin is found that lines the wall of the exit tunnel in the center of the 70S ribosome (By similarity)(COG0091) |
| Kegg | - |
| CantataDB | Link to cantataDB annotations (CNT0000618) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_013446562.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |