Id Trinity | FTRINITY_DN56988_c0_g2_i5 |
---|---|
Name Transcript | Ll_transcript_204360 |
Sequence | GTTGTCTAAAAATGACTCCAAACCATTTGACAATCCCACTCTGTTTAGGTCAATAGTTGGAGCACTTCAATATGCTACAATTACAAGACCTGATCTTGCC TTTAGTGTGAATAAAGTGTGTCAATTTATGAGTAAACCTCTTGAACAACACTGGGTTGCAGTGAAAAGGATCCTAAGGTATCTTCAAGGTACTATGACTT TTGGCATTCATCTCAAGGCTGCTGTTTGTCCCTCTATGCCTATTCATCTCACTGCTTTATGTGATGCTGATTGGGCTACTGATCTTGATGATAGAAAGTC TGTTTCAGGGGCATGCCTATTTCTTGGTCCTAATATTATAGCTTGGTGGTCAAGGAAGCAACAAACAGTGTCTAGATCCAGCACTGAAGCTGAATATAGA AGCCTTGCTCTTGCTTCTCAAGAATTGGTTTGGGTTGAATCCTTGTTGACTGAACTCAAAGTTCC BLAST |
Tissue | flowers |
Gene name | LI_gene_64880; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_204360
Blastp | Uncharacterized mitochondrial protein AtMg00810 from Arabidopsis with 48.53% of identity |
---|---|
Blastx | Uncharacterized mitochondrial protein AtMg00810 from Arabidopsis with 48.53% of identity |
Eggnog | Retrotransposon protein(COG2801) |
Kegg | Link to kegg annotations (ArthMp070) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019429729.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |