Id Trinity | FTRINITY_DN57145_c1_g2_i4 |
---|---|
Name Transcript | Ll_transcript_99161 |
Sequence | CATTTAAGTGGCTCCCCATTCCCCTTGCCTTCACTCTCTCCTCTTCATATTTAGTTTTGTTGAGCAGTGAAAAAAGAAAGAATCACAAACAAACAAAAAC TCTCTCTTCTTCTGAGATTCACTTTCAATATTCTATCAAATGGCTCTGAGAATGAATCCTCTTCAAACCCAAACTTCAATCCCTCAGATTGTTAGTCTCA GATCTCCCAAATTCCTCATGGCCTCTACCCTTCGCACTGGCTCTAAAGAGGTTGAAAATATTAAGAAGCCTTTCAGTCCTCCCAGAGAAGTGCATGTTCA AGTCACCCACTCCATGCCACCCCAGAAGATTGAGATTTTCAAATCTCTAGAGGATTGGGCTGACAAGAACATCTTGGTTCACCTTAAACCTGTCGAAAAA TGTTGGCAACCACAGGATTTCCTACCAGATGCTTCCGCAGATGGATTTGAAGAGCAAGTGAAGGAACTGAGAGAGAGAGCAAAGGAGCTTCCAGATGGAT TTGAAGAGCAAGTGAAGGAACTGAGAGAGAG BLAST |
Tissue | flowers |
Gene name | LI_gene_66217; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_99161
Blastp | Stearoyl-[acyl-carrier-protein] 9-desaturase, chloroplastic from Soja with 84.43% of identity |
---|---|
Blastx | Stearoyl-[acyl-carrier-protein] 9-desaturase, chloroplastic from Soja with 84.43% of identity |
Eggnog | Converts stearoyl-ACP to oleoyl-ACP by introduction of a cis double bond between carbons Delta(9) and Delta(10) of the acyl chain(ENOG410XPNS) |
Kegg | Link to kegg annotations (547808) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019434321.1) |
Pfam | Fatty acid desaturase (PF03405.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |