Id Trinity | FTRINITY_DN57184_c0_g1_i8 |
---|---|
Name Transcript | Ll_transcript_100023 |
Sequence | GGAAAAGGCTTCAACCATTGATCTTTTGTTGTGTTATTCGTTCGTGACTTCGTTCAATCTTATATATGTGGATTTGTGCATATCTGACAAAGAATGCTTT TGCAGGTATGCGCGCACTTTTGCATTCTTTTATACCATTGGATTGCATATCTTGGTCTTCACTTGTCTCTATCGAATGTCTGCTTTGAGTTATCTTAGCA ATGGCCCA BLAST |
Tissue | flowers |
Gene name | LI_gene_66532; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_100023
Blastp | - |
---|---|
Blastx | Protein CASP from Arabidopsis with 88.24% of identity |
Eggnog | Cut-like homeobox(ENOG410XPRP) |
Kegg | Link to kegg annotations (AT3G18480) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019448393.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |