Ll_transcript_54028

• Id Trinity: FTRINITY_DN57206_c1_g1_i1
• Name Transcript: Ll_transcript_54028
• Sequence: CTTCGCTTTCTCTCCAATCACTCGCCTTTTCAACAGAATCATCCGAAGTGTTGTTATGGAGGAGCAATTCATACTTAGAGTTCCACCAAGTGTTGCAGAG CGAATAGAGCGTCTTCTTAACAACAACAACATTAATAATAGTGATGCTCCATCTTCTTCATCTGAGGACAACAAGTCATTAGATTTGTCTTTTAGTGAGG ATGGCAGAAGTGGTTCCTTCTTGATTGGCAATGAACGATTCCCAGCATCTCTCTTGGACCTTCCTTGTGTCGTTGAATCGTTTAAAACTTATGATGATAG TTCTTTGATTAAAACAGCTGATATTGCTCAGATGATTATGGTGAGGGAATC
• Tissue: flowers
• Gene name: LI_gene_66718;
• Additional information: details;

Expression of Ll_transcript_54028

FPKM

• FPAB: 7.4
• FPNAB: 9.1
• LF1: 6.2
• LF2: 4
• LF3: 6
• LF4: 7.4
• UF1: 8
• UF2: 7.6
• UF3: 11
• UF4: 8.5

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_54028

• Blastp: Transcription initiation factor TFIID subunit 7 from Arabidopsis with 68.37% of identity
• Blastx: Transcription initiation factor TFIID subunit 7 from Arabidopsis with 67.35% of identity
• Eggnog: RNA polymerase II, TATA box binding protein (TBP)-associated factor(COG5414)
• Kegg: Link to kegg annotations (AT1G55300)
• CantataDB: Link to cantataDB annotations (CNT0001798)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019416674.1)
• Pfam: TAFII55 protein conserved region (PF04658.12)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;