| Id Trinity | FTRINITY_DN57207_c4_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_53405 |
| Sequence | CTTGGCCCATGATGCATTAACACATTACAAACGATGGGAAGAAGAGATTGAGAAATGGCAAAGTCCTGTTCTTAAGGATGAGAAACTACCAGAATGGTAC AAGTTTACATTATTTAATGAACTCTACTTTCTCGTTGCTGGAGGAACAATTTGGATTGGTATGTATGCATATAAGTGTGTTGCATTGCAGTCGAGTTATC TTCGATAAAAGTCTGGCATGTCATTGCTGGTGTCTATTGTCAGTTTAGTCATAATGGAACCATTAAGAATTCTTTGATTTTTGTGCCAGATTCTCCTCTG CTAGCTTCGAATATGGGAAACGACCAGâBLAST |
| Tissue | flowers |
| Gene name | LI_gene_66725; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_53405
| Blastp | - |
|---|---|
| Blastx | Non-lysosomal glucosylceramidase from Mus with 61.54% of identity |
| Eggnog | Non-lysosomal glucosylceramidase that catalyzes the conversion of glucosylceramide to free glucose and ceramide (By similarity)(COG4354) |
| Kegg | Link to kegg annotations (230101) |
| CantataDB | Link to cantataDB annotations (CNT0001180) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019441068.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |